pSB-CMV-MCS-Puro-ArfGAP1_ALPS1-mKate2-3NLS-P2A-eGFP-LMNB1
(Plasmid
#250914)
-
PurposeDual color expression of mKate2-3xNLS tagged rat ALPS1 and eGFP tagged zebrafish Lamin B1 in mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.1
- Backbone size w/o insert (bp) 5662
- Total vector size (bp) 9190
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArfGAP1-mKate2-3xNLS-P2A-EGFP-LMNB1
-
Alt nameArfGAP1 ALPS1 domain, Lamin B1
-
SpeciesR. norvegicus (rat), D. rerio (zebrafish)
-
Insert Size (bp)3528
-
MutationARFGAP1 amino acids 196–234 only
-
Entrez Genelmnb1 (a.k.a. fc06g01, wu:fc06g01)
-
Entrez GeneArfgap1 (a.k.a. Arf GAP1, Arf1gap)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mKate2 on ArfGAP1 (C terminal on insert)
- EGFP on LMNB1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV-Forward)
- 3′ sequencing primer tagaaggcacagtcgagg (BGHR)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-CMV-MCS-Puro-ArfGAP1_ALPS1-mKate2-3NLS-P2A-eGFP-LMNB1 was a gift from Philipp Niethammer (Addgene plasmid # 250914 ; http://n2t.net/addgene:250914 ; RRID:Addgene_250914) -
For your References section:
Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519