hsp70I: cPla-mKate2-P2A-EGFP-KDEL
(Plasmid
#250915)
-
PurposeDual color expression of mKate2 tagged zebrafish cPla2 and ER markers (EGFP-KDEL) in zebrafish live tissue after heat shock
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCB59
- Backbone size w/o insert (bp) 7529
- Total vector size (bp) 11566
-
Vector typeD.rerio (zebrafish)
-
Selectable markersCRYBB1 (beta-crystallin B1):mKate2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecPla2-mKate2-P2A-EGFP-KDEL
-
Alt namephospholipase A2, group IVAa
-
Alt namecPla2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)7368
-
Entrez Genepla2g4aa (a.k.a. PLA2G4A, cpla2, pla2g4)
- Promoter hsp70i
-
Tags
/ Fusion Proteins
- mKate2 on cPla2 (C terminal on insert)
- KDEL on EGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAAGTTTgtacaaaaaagcag (ATTB1)
- 3′ sequencing primer caactatgtataataaagttg (ATTB3)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hsp70I: cPla-mKate2-P2A-EGFP-KDEL was a gift from Philipp Niethammer (Addgene plasmid # 250915 ; http://n2t.net/addgene:250915 ; RRID:Addgene_250915) -
For your References section:
Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519