Skip to main content

hsp70I: cPla-mKate2-P2A-EGFP-KDEL
(Plasmid #250915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250915 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCB59
  • Backbone size w/o insert (bp) 7529
  • Total vector size (bp) 11566
  • Vector type
    D.rerio (zebrafish)
  • Selectable markers
    CRYBB1 (beta-crystallin B1):mKate2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cPla2-mKate2-P2A-EGFP-KDEL
  • Alt name
    phospholipase A2, group IVAa
  • Alt name
    cPla2
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    7368
  • Entrez Gene
    pla2g4aa (a.k.a. PLA2G4A, cpla2, pla2g4)
  • Promoter hsp70i
  • Tags / Fusion Proteins
    • mKate2 on cPla2 (C terminal on insert)
    • KDEL on EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAAGTTTgtacaaaaaagcag (ATTB1)
  • 3′ sequencing primer caactatgtataataaagttg (ATTB3)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hsp70I: cPla-mKate2-P2A-EGFP-KDEL was a gift from Philipp Niethammer (Addgene plasmid # 250915 ; http://n2t.net/addgene:250915 ; RRID:Addgene_250915)
  • For your References section:

    Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519