pKC148_Lenti_Tetoff_MVP_EF1a_tagRFP
(Plasmid
#250949)
-
PurposeA lentiviral vector express MVP gene under a Tetoff system. Contains tagRFP as selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G
-
Backbone manufacturerEmma Rawlins (Addgene plasmid # 167935)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markerstagRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMVP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2679
-
Entrez GeneMVP (a.k.a. LRP, VAULT1)
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCAAAAGGTATAGGAACTTCGCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThomas Muir (Addgene plasmid # 202206)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKC148_Lenti_Tetoff_MVP_EF1a_tagRFP was a gift from Fei Chen (Addgene plasmid # 250949 ; http://n2t.net/addgene:250949 ; RRID:Addgene_250949) -
For your References section:
A genetically encoded device for transcriptome storage in mammalian cells. Chao YK, Wu M, Gong Q, Chen F. Science. 2026 Jan 15:eadz9353. doi: 10.1126/science.adz9353. 10.1126/science.adz9353 PubMed 41538410