pFSD-SIBR003
(Plasmid
#250973)
-
PurposeFSD expressing SIBR-Cas system with intron 3, contains restriction sites to introduce HR and spacer sequence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFSD
- Backbone size w/o insert (bp) 5278
- Total vector size (bp) 9889
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSIBR003 system (SIBR Intron 3 FnCas12a)
-
SpeciesSynthetic
-
Insert Size (bp)4611
- Promoter lacUV5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MunI (not destroyed)
- 3′ cloning site MunI (not destroyed)
- 5′ sequencing primer cggataacaatttcacacaggag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySIBR003 cassette is cloned from Addgene plasmid #177666
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFSD-SIBR003 was a gift from Peter Sarin (Addgene plasmid # 250973 ; http://n2t.net/addgene:250973 ; RRID:Addgene_250973) -
For your References section:
Queuosine promotes wecB-dependent phage resistance and biofilm formation in marine bacterium Shewanella glacialimarina. Gregorova P, Heinonen MMK, Sipari N, Sarin LP. bioRxiv 2026.03.05.709803 10.64898/2026.03.05.709803