Skip to main content

pFSD-SIBR004
(Plasmid #250974)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250974 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFSD
  • Backbone size w/o insert (bp) 5278
  • Total vector size (bp) 9889
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SIBR004 system (SIBR Intron 4 FnCas12a)
  • Species
    Synthetic
  • Insert Size (bp)
    4611
  • Promoter lacUV5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MunI (not destroyed)
  • 3′ cloning site MunI (not destroyed)
  • 5′ sequencing primer cggataacaatttcacacaggag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SIBR004 cassette is cloned from Addgene plasmid #177667

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFSD-SIBR004 was a gift from Peter Sarin (Addgene plasmid # 250974 ; http://n2t.net/addgene:250974 ; RRID:Addgene_250974)
  • For your References section:

    Queuosine promotes wecB-dependent phage resistance and biofilm formation in marine bacterium Shewanella glacialimarina. Gregorova P, Heinonen MMK, Sipari N, Sarin LP. bioRxiv 2026.03.05.709803 10.64898/2026.03.05.709803