pAH_DEST_nHalo-Sec61β-3XFLAG
(Plasmid
#250996)
-
PurposeExpression of Sec61β with N-terminal Halo and C-terminal 3XFLAG tags
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAH_DEST_nHalo-3XFLAG
-
Backbone manufacturerDNASU
- Total vector size (bp) 6035
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSEC61β
-
SpeciesH. sapiens (human)
-
Insert Size (bp)291
-
Entrez GeneSEC61B
- Promoter CMV
-
Tags
/ Fusion Proteins
- Halo Tag (N terminal on backbone)
- 3XFLAG (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTAATTGCAAGGCCGTGGATATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe vector backbone was originally acquired from DNASU (cat no: EvNO00983632) and is under a MTA with the University of Iowa.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH_DEST_nHalo-Sec61β-3XFLAG was a gift from Anthony Pedley (Addgene plasmid # 250996 ; http://n2t.net/addgene:250996 ; RRID:Addgene_250996) -
For your References section:
Coordination of cell organelles to promote metabolon formation. Sha Z, Pedley AM, Iles TD, Zhang S, Staub JR, Zhou R, Benkovic SJ. Proc Natl Acad Sci U S A. 2026 Feb 3;123(5):e2532504123. doi: 10.1073/pnas.2532504123. Epub 2026 Jan 26. 10.1073/pnas.2532504123 PubMed 41587318