Skip to main content

pmScarlet-i-Sec61β
(Plasmid #250997)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250997 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 4896
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SEC61β
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    291
  • Entrez Gene
    SEC61B
  • Promoter CMV
  • Tag / Fusion Protein
    • mScarlet (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer gcaatagcatcacaaatttc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original gene insert (mScarlet-i-SEC61b) was amplified from pLVX-TetONE-mScarlet-i-Sec61β, a plasmid acquired as a gift from Volker Haucke from Leibniz-Forschungsinstitut für Molekulare Pharmakologie in Berlin, Germany.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmScarlet-i-Sec61β was a gift from Anthony Pedley (Addgene plasmid # 250997 ; http://n2t.net/addgene:250997 ; RRID:Addgene_250997)
  • For your References section:

    Coordination of cell organelles to promote metabolon formation. Sha Z, Pedley AM, Iles TD, Zhang S, Staub JR, Zhou R, Benkovic SJ. Proc Natl Acad Sci U S A. 2026 Feb 3;123(5):e2532504123. doi: 10.1073/pnas.2532504123. Epub 2026 Jan 26. 10.1073/pnas.2532504123 PubMed 41587318