pmScarlet-i-Sec61β
(Plasmid
#250997)
-
PurposeExpression of Sec61β with an N-terminal mScarlet tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Total vector size (bp) 4896
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSEC61β
-
SpeciesH. sapiens (human)
-
Insert Size (bp)291
-
Entrez GeneSEC61B
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer gcaatagcatcacaaatttc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original gene insert (mScarlet-i-SEC61b) was amplified from pLVX-TetONE-mScarlet-i-Sec61β, a plasmid acquired as a gift from Volker Haucke from Leibniz-Forschungsinstitut für Molekulare Pharmakologie in Berlin, Germany.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmScarlet-i-Sec61β was a gift from Anthony Pedley (Addgene plasmid # 250997 ; http://n2t.net/addgene:250997 ; RRID:Addgene_250997) -
For your References section:
Coordination of cell organelles to promote metabolon formation. Sha Z, Pedley AM, Iles TD, Zhang S, Staub JR, Zhou R, Benkovic SJ. Proc Natl Acad Sci U S A. 2026 Feb 3;123(5):e2532504123. doi: 10.1073/pnas.2532504123. Epub 2026 Jan 26. 10.1073/pnas.2532504123 PubMed 41587318