Clu-2A-mCherry
(Plasmid
#251158)
-
PurposeLentiviral expression of mouse Clu-2A-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcf221
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameClu
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1284
-
Mutationdeletion of ER signal (AA 2-21)
-
GenBank ID
-
Entrez GeneClu (a.k.a. ApoJ, Cli, D14Ucla3, SP-40, Sgp-2, Sgp2, Sugp-2)
- Promoter Ef1a
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atttgccctttttgagtttggatc
- 3′ sequencing primer aaggcattaaagcagcgtatcca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Clu-2A-mCherry was a gift from Yi Zhang (Addgene plasmid # 251158 ; http://n2t.net/addgene:251158 ; RRID:Addgene_251158) -
For your References section:
Clusterin drives myeloid bias in aged hematopoietic stem cells by regulating mitochondrial function. Sun N, Lin CH, Li MY, Wang Y, Chen D, Ren X, Zhang F, Zhang Y. Nat Aging. 2025 Aug;5(8):1510-1527. doi: 10.1038/s43587-025-00908-z. Epub 2025 Jun 30. 10.1038/s43587-025-00908-z PubMed 40588652