Skip to main content

Clu-2A-mCherry
(Plasmid #251158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251158 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcf221
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Clu
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1284
  • Mutation
    deletion of ER signal (AA 2-21)
  • GenBank ID
  • Entrez Gene
    Clu (a.k.a. ApoJ, Cli, D14Ucla3, SP-40, Sgp-2, Sgp2, Sugp-2)
  • Promoter Ef1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atttgccctttttgagtttggatc
  • 3′ sequencing primer aaggcattaaagcagcgtatcca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Clu-2A-mCherry was a gift from Yi Zhang (Addgene plasmid # 251158 ; http://n2t.net/addgene:251158 ; RRID:Addgene_251158)
  • For your References section:

    Clusterin drives myeloid bias in aged hematopoietic stem cells by regulating mitochondrial function. Sun N, Lin CH, Li MY, Wang Y, Chen D, Ren X, Zhang F, Zhang Y. Nat Aging. 2025 Aug;5(8):1510-1527. doi: 10.1038/s43587-025-00908-z. Epub 2025 Jun 30. 10.1038/s43587-025-00908-z PubMed 40588652