Skip to main content

PTPMT1_BirA*
(Plasmid #251205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251205 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBabe puro
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1
  • Alt name
    PTPMT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1653
  • GenBank ID
    BC020242.1
  • Entrez Gene
    PTPMT1 (a.k.a. DUSP23, MOSP, NEDAXBA, PLIP, PNAS-129)
  • Tag / Fusion Protein
    • BirA* (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORFeome Library; Genome Biology Unit supported by HiLIFE, Faculty of Biological and Environmental Sciences, University of Helsinki, and Biocenter Finland.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PTPMT1_BirA* was a gift from Svetlana Konovalova (Addgene plasmid # 251205 ; http://n2t.net/addgene:251205 ; RRID:Addgene_251205)