PHB2_BirA*
(Plasmid
#251207)
-
PurposeExpresses human PHB2 tagged with BirA* in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBabe puro
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProhibitin 2
-
Alt namePHB2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1950
-
GenBank IDBC014766.1
-
Entrez GenePHB2 (a.k.a. BAP, BCAP37, Bap37, PNAS-141, REA, hBAP, p22)
-
Tag
/ Fusion Protein
- BirA* (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTTTATCCAGCCCTCAC
- 3′ sequencing primer ACCCTAACTGACACACATTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byORFeome Library; Genome Biology Unit supported by HiLIFE, Faculty of Biological and Environmental Sciences, University of Helsinki, and Biocenter Finland.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PHB2_BirA* was a gift from Svetlana Konovalova (Addgene plasmid # 251207 ; http://n2t.net/addgene:251207 ; RRID:Addgene_251207)