pMTL-YN1C Promoter-less mNeonGreen
(Plasmid
#251223)
-
PurposepMTL-YN1C encoding a promoter-less mNeonGreen.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMTL-YN1c
- Backbone size w/o insert (bp) 6064
- Total vector size (bp) 6852
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLeader peptide with mNeonGreen codon optimized for C. difficile
-
SpeciesC. difficile
-
Insert Size (bp)788
- Promoter Promoter-less
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgatgagtgtcctttatgtaagg
- 3′ sequencing primer taacgccagggttttccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTL-YN1C Promoter-less mNeonGreen was a gift from Aimee Shen (Addgene plasmid # 251223 ; http://n2t.net/addgene:251223 ; RRID:Addgene_251223)