CAG-rtTA
(Plasmid
#251230)
-
PurposeCAG-rtTA plasmid for integration into genomic safe harbor loci using CAS9-PBase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggybac
-
Backbone manufacturerIn house
- Backbone size w/o insert (bp) 3566
- Total vector size (bp) 5691
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAG-rtTA
-
SpeciesSynthetic
-
Insert Size (bp)2125
- Promoter cag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttgataccgcgggcccgggccgccaccatgtctagactggac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-rtTA was a gift from Gary Hon (Addgene plasmid # 251230 ; http://n2t.net/addgene:251230 ; RRID:Addgene_251230)