CYLBL_Neo_TREdCas9-KRAB
(Plasmid
#251231)
-
PurposeTRE-dCas9-KRAB knock-in using TALEN at CLYBL locus (derived from Plasmid #220439)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251231 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCYLBL_Neo_CAGdCas9-KRAB
-
Backbone manufacturerAddgene_220439
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 12136
-
Modifications to backboneoriginal CLYBL_Neo_CAGdCas9-KRAB was obtained from Yin Shen's lab. It was modified to change CAG promoter to TRE and selection cassette from Neo to PTK.
-
Vector typeMammalian Expression, CRISPR, TALEN
-
Selectable markersPuromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE-dCas9 KRAB
-
SpeciesSynthetic
-
Insert Size (bp)5377
-
MutationD10A and H840A
- Promoter TRE
-
Tag
/ Fusion Protein
- KRAB (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agagaacgtatctacagtttactccc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byObtained insert from Yin Shen, Addgene plasmid 220439
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CYLBL_Neo_TREdCas9-KRAB was a gift from Gary Hon (Addgene plasmid # 251231 ; http://n2t.net/addgene:251231 ; RRID:Addgene_251231)