SFFV-ZIM3-dCas9-2A-mCherry
(Plasmid
#251398)
-
PurposeLentiviral expression plasmid of ZIM3-dCas9 with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiV
- Total vector size (bp) 11865
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZIM3
-
SpeciesSynthetic
-
MutationIncludes ZIM3 aa 1-100
-
Entrez GeneZIM3 (a.k.a. ZNF657)
- Promoter SFFV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcttcccgagctctataaaagag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SFFV-ZIM3-dCas9-2A-mCherry was a gift from Junwei Shi (Addgene plasmid # 251398 ; http://n2t.net/addgene:251398 ; RRID:Addgene_251398) -
For your References section:
CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples. Cao Z, Yu S, Peng J, Barrett DR, Liu Y, Sussman JH, Chen C, Thadi A, Liu L, Alikarami F, Xu J, Carroll MP, Tan K, Bernt KM, Shi J. Mol Cell. 2026 Mar 5;86(5):968-985.e7. doi: 10.1016/j.molcel.2026.02.003. Epub 2026 Feb 26. 10.1016/j.molcel.2026.02.003 PubMed 41759529