Skip to main content

pGA1-EF1α-sfGFP150TAG-4xtRNA
(Plasmid #251517)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251517 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGA1
  • Backbone size w/o insert (bp) 6119
  • Total vector size (bp) 6836
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfGFP150TAG
  • Species
    Synthetic
  • Mutation
    150 TAG (amino acid 150 mutated to stop codon)
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • His6 (C terminal on insert)
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaaaccatggtggcaagcttaagtttaaacgctagccatca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGA1-EF1α-sfGFP150TAG-4xtRNA was a gift from Ryan Mehl (Addgene plasmid # 251517 ; http://n2t.net/addgene:251517 ; RRID:Addgene_251517)
  • For your References section:

    Endogenous Site-Specific Encoding of Trifluoromethyl-Bearing Phenylalanine and Tryptophan for in-Cell (19)F NMR. Augustin G, Bhinderwala F, Alexander ND, Hernandez I, Stanisheuski S, Monnie CM, Eddins AJ, Gangarde YM, Soloshonok VA, Oiarbide M, Landa A, Cooley RB, Gronenborn AM, Mehl RA. J Am Chem Soc. 2026 Feb 12. doi: 10.1021/jacs.5c18349. 10.1021/jacs.5c18349 PubMed 41684198