Skip to main content
Addgene
Open Menu

pAcBAc1-Ma-tfmW-RSA2
(Plasmid #251519)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 251519 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pAcBAc1-Ma
  • Backbone size w/o insert (bp) 9010
  • Total vector size (bp) 9488
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ma-tfmW-RSA2
  • Species
    Synthetic
  • Insert Size (bp)
    834
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gagacccaagctggctagcgccaccatgacagtgaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcBAc1-Ma-tfmW-RSA2 was a gift from Ryan Mehl (Addgene plasmid # 251519 ; http://n2t.net/addgene:251519 ; RRID:Addgene_251519)

  • For your References section:

    Endogenous Site-Specific Encoding of Trifluoromethyl-Bearing Phenylalanine and Tryptophan for in-Cell (19)F NMR. Augustin G, Bhinderwala F, Alexander ND, Hernandez I, Stanisheuski S, Monnie CM, Eddins AJ, Gangarde YM, Soloshonok VA, Oiarbide M, Landa A, Cooley RB, Gronenborn AM, Mehl RA. J Am Chem Soc. 2026 Feb 12. doi: 10.1021/jacs.5c18349. 10.1021/jacs.5c18349 PubMed 41684198
Related items: