pAJE90-Ma-tfmW-RSA2
(Plasmid
#251520)
-
PurposeMachinery plasmid expressing Methanomethylophilus alvus aaRS/tRNA for TAG suppression and incorporation of trifluoromethyl-tryptophan (tfm-Trp) into sfGFP150TAG in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAJE90
- Backbone size w/o insert (bp) 2020
- Total vector size (bp) 2854
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMa-tfmW-RSA2
-
SpeciesSynthetic
-
Insert Size (bp)834
- Promoter Gln S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer cgcttataagatcatacgccgttatac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAJE90-Ma-tfmW-RSA2 was a gift from Ryan Mehl (Addgene plasmid # 251520 ; http://n2t.net/addgene:251520 ; RRID:Addgene_251520) -
For your References section:
Endogenous Site-Specific Encoding of Trifluoromethyl-Bearing Phenylalanine and Tryptophan for in-Cell (19)F NMR. Augustin G, Bhinderwala F, Alexander ND, Hernandez I, Stanisheuski S, Monnie CM, Eddins AJ, Gangarde YM, Soloshonok VA, Oiarbide M, Landa A, Cooley RB, Gronenborn AM, Mehl RA. J Am Chem Soc. 2026 Feb 12. doi: 10.1021/jacs.5c18349. 10.1021/jacs.5c18349 PubMed 41684198