Skip to main content

lentiCRISPR v2-sgSLC11A2
(Plasmid #251684)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251684 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Backbone size w/o insert (bp) 12000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC11A2 solute carrier family 11 member 2
  • gRNA/shRNA sequence
    TCCTAAAGATAACTCGACAC
  • Species
    H. sapiens (human)
  • Entrez Gene
    SLC11A2 (a.k.a. AHMIO1, DCT1, DMT1, NRAMP2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgSLC11A2 was a gift from Boyi Gan (Addgene plasmid # 251684 ; http://n2t.net/addgene:251684 ; RRID:Addgene_251684)
  • For your References section:

    Radiotherapy promotes cuproptosis and synergizes with cuproptosis inducers to overcome tumor radioresistance. Lei G, Sun M, Cheng J, Ye R, Lu Z, Horbath A, Huo D, Wu S, Alapati A, Aggarwal S, Xu Z, Mao C, Yan Y, Yao J, Li Q, Chen X, Lee H, Zhuang L, Jiang D, Pataer A, Roth JA, Navin N, Koong AC, You MJ, Lin SH, Gan B. Cancer Cell. 2025 Jun 9;43(6):1076-1092.e5. doi: 10.1016/j.ccell.2025.03.031. Epub 2025 Apr 10. 10.1016/j.ccell.2025.03.031 PubMed 40215978