lentiCRISPR v2-sgMT1X-1
(Plasmid
#251692)
-
PurposegRNA to knock out MT1X in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang (Addgene #52961)
- Backbone size w/o insert (bp) 12000
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMT1X metallothionein 1X
-
gRNA/shRNA sequenceACAGGAGCCAACAGGCGAGC
-
SpeciesH. sapiens (human)
-
Entrez GeneMT1X (a.k.a. MT-1l, MT1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgMT1X-1 was a gift from Boyi Gan (Addgene plasmid # 251692 ; http://n2t.net/addgene:251692 ; RRID:Addgene_251692) -
For your References section:
Radiotherapy promotes cuproptosis and synergizes with cuproptosis inducers to overcome tumor radioresistance. Lei G, Sun M, Cheng J, Ye R, Lu Z, Horbath A, Huo D, Wu S, Alapati A, Aggarwal S, Xu Z, Mao C, Yan Y, Yao J, Li Q, Chen X, Lee H, Zhuang L, Jiang D, Pataer A, Roth JA, Navin N, Koong AC, You MJ, Lin SH, Gan B. Cancer Cell. 2025 Jun 9;43(6):1076-1092.e5. doi: 10.1016/j.ccell.2025.03.031. Epub 2025 Apr 10. 10.1016/j.ccell.2025.03.031 PubMed 40215978