Skip to main content

MTS-EGFP-FLAG-APEX2
(Plasmid #251713)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251713 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mitochondrial targeting sequence (MTS)
  • Species
    H. sapiens (human)
  • Entrez Gene
    APEX2 (a.k.a. APE2, APEXL2, XTH2, ZGRF2)
  • Tags / Fusion Proteins
    • EGFP (C terminal on insert)
    • FLAG (C terminal on insert)
    • APEX2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene 11795 and Addgene 71877

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MTS-EGFP-FLAG-APEX2 was a gift from Svetlana Konovalova (Addgene plasmid # 251713 ; http://n2t.net/addgene:251713 ; RRID:Addgene_251713)