ER-EGFP-FLAG-APEX2
(Plasmid
#251714)
-
PurposeExpresses ER localized EGFP-FLAG-APEX2 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251714 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER signal peptide
-
SpeciesH. sapiens (human)
-
Entrez GeneAPEX2 (a.k.a. APE2, APEXL2, XTH2, ZGRF2)
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- FLAG (C terminal on insert)
- APEX2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 11795
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER-EGFP-FLAG-APEX2 was a gift from Svetlana Konovalova (Addgene plasmid # 251714 ; http://n2t.net/addgene:251714 ; RRID:Addgene_251714)