ST13P4_pEGFP-C1-2µ-URA3
(Plasmid
#251715)
-
PurposeExpresses human ST13P4 tagged with EGFP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 7525
- Total vector size (bp) 8626
-
Modifications to backbone2micronURA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameST13P4
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003932.5
-
Entrez GeneST13P4 (a.k.a. FAM10A4, FAM10A4P)
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byORFeome Library; Genome Biology Unit supported by HiLIFE, Faculty of Biological and Environmental Sciences, University of Helsinki, and Biocenter Finland.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ST13P4_pEGFP-C1-2µ-URA3 was a gift from Svetlana Konovalova (Addgene plasmid # 251715 ; http://n2t.net/addgene:251715 ; RRID:Addgene_251715)