Skip to main content

SURF6_pEGFP-C1-2µ-URA3
(Plasmid #251718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 7525
  • Total vector size (bp) 8603
  • Modifications to backbone
    2micronURA3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SURF6
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_006753.6
  • Entrez Gene
    SURF6 (a.k.a. RRP14)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORFeome Library; Genome Biology Unit supported by HiLIFE, Faculty of Biological and Environmental Sciences, University of Helsinki, and Biocenter Finland.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SURF6_pEGFP-C1-2µ-URA3 was a gift from Svetlana Konovalova (Addgene plasmid # 251718 ; http://n2t.net/addgene:251718 ; RRID:Addgene_251718)