CAG-LifeCamp
(Plasmid
#251723)
-
PurposeExpression of calcium lifetime sensor LifeCamp under CAG promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4848
- Total vector size (bp) 6957
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLifeCamp
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgcatcatcaccatcatcacacgc
- 3′ sequencing primer tttatagagttcgtccattcccaatgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.23.696288 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-LifeCamp was a gift from Bernardo Sabatini (Addgene plasmid # 251723 ; http://n2t.net/addgene:251723 ; RRID:Addgene_251723) -
For your References section:
Rapid fluorescence lifetime sensor development of LifeCamp enables transient and baseline absolute calcium measurements. Lodder B, Raghubardayal M, Ganesh S, Cai X, Stern J, Sherman M, Rosen P, Kamath T, Hartman I, Siegel M, Timmins J, Adan R, Andermann M, Sabatini BL. bioRxiv 2025.12.23.696288 10.64898/2025.12.23.696288