pQS-AR
(Plasmid #251746)

• Purpose: Quorum sensing system for delayed GFP expression at moderate cell density (OD~10)
• Depositing Lab: Yilan Liu
• Publication: Model-driven engineering of synthetic quorum-sensing circuits enables wide-range dynamic control (unpublished)

Backbone

• Vector backbone: pK18
• Backbone size w/o insert (bp): 2105
• Total vector size (bp): 4504
• Vector type: Bacterial Expression ; p15A origin, KanR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: luxR
• Insert Size (bp): 753
• Promoter: PluxI

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGAAACAGCTATGAC

Gene/Insert 2

• Gene/Insert name: luxI
• Insert Size (bp): 575
• Promoter: Constitutive promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTAAAACGACGGCCAGT

Gene/Insert 3

• Gene/Insert name: eGFP
• Insert Size (bp): 720
• Promoter: PluxI

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGATCTACCTGTAGGATCGTAC

Resource Information

• Supplemental Documents:
  • VG85BK_5_p15a-qGFP-luxR1-1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry