pQS-AR
(Plasmid
#251746)
-
PurposeQuorum sensing system for delayed GFP expression at moderate cell density (OD~10)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepK18
- Backbone size w/o insert (bp) 2105
- Total vector size (bp) 4504
-
Vector typeBacterial Expression ; p15A origin, KanR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameluxR
-
Insert Size (bp)753
- Promoter PluxI
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameluxI
-
Insert Size (bp)575
- Promoter Constitutive promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
- Promoter PluxI
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer AGATCTACCTGTAGGATCGTAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQS-AR was a gift from Yilan Liu (Addgene plasmid # 251746 ; http://n2t.net/addgene:251746 ; RRID:Addgene_251746)