erCRY1b full length
(Plasmid
#252023)
-
Purposefor ITC
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepfastbac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6461
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEuropean robin cry 1b
-
Specieseuropen robin
-
Insert Size (bp)1761
-
GenBank IDKT380949
- Promoter p10
-
Tag
/ Fusion Protein
- His tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site rsrII (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CCTATAAATATTCCGGATTATTCATACC
- 3′ sequencing primer ACAAATGTGGTATGGCTGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
erCRY1b full length was a gift from Joseph Takahashi (Addgene plasmid # 252023 ; http://n2t.net/addgene:252023 ; RRID:Addgene_252023) -
For your References section:
Structure of European robin cryptochrome 1 reveals a role in circadian rhythms, not magnetoreception. Wickramaratne AC, Rasmussen ES, Chelliah Y, Schuhmann F, Solov'yov IA, Mouritsen H, Green CB, Zoltowski BD, Takahashi JS. iScience. 2025 Nov 11;28(12):114015. doi: 10.1016/j.isci.2025.114015. eCollection 2025 Dec 19. 10.1016/j.isci.2025.114015 PubMed 41488359