pVT0494 MULTI-assembly vector with HuABC2 Variable Heavy Domain
(Plasmid
#252076)
-
PurposeVector for MULTI-assembly cloning for HuABC2 Variable Heavy Domain variants; replace HuABC2 insert with gene of interest via Gibson Assembly
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSMART HC_Amp
- Backbone size w/o insert (bp) 1831
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuABC2 variable heavy domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)371
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGAAACGCCTGGTATCTTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVT0494 MULTI-assembly vector with HuABC2 Variable Heavy Domain was a gift from Patrick Hsu (Addgene plasmid # 252076 ; http://n2t.net/addgene:252076 ; RRID:Addgene_252076) -
For your References section:
Rapid directed evolution guided by protein language models and epistatic interactions. Tran VQ, Nemeth M, Bartie LJ, Chandrasekaran SS, Fanton A, Moon HC, Hie BL, Konermann S, Hsu PD. Science. 2026 Feb 19:eaea1820. doi: 10.1126/science.aea1820. 10.1126/science.aea1820 PubMed 41712694