Skip to main content

pCW57-GFP-P2A-EcASPase
(Plasmid #252079)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252079 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57-GFP-P2A-MCS (Neo)
  • Backbone manufacturer
    Broad Institute/Adam Karpf
  • Backbone size w/o insert (bp) 8700
  • Total vector size (bp) 10200
  • Modifications to backbone
    NA
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
  • Selectable markers
    Neomycin (select with G418) ; Turbo GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon optimized E.coli derived aspartate ammonia-lyase
  • Alt name
    aspA
  • Species
    E.coli
  • Insert Size (bp)
    1488
  • Mutation
    Codon optimized
  • GenBank ID
    Gene ID: 948658
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-GFP-P2A-EcASPase was a gift from Lydia Finley (Addgene plasmid # 252079 ; http://n2t.net/addgene:252079 ; RRID:Addgene_252079)
  • For your References section:

    Aspartate availability drives differential engagement of the malate-aspartate shuttle. Brunner JS, Bridgeman AE, Jackson BT, Chakraborty S, Fagoaga-Eugui M, Paras KI, Xie A, Arnold PK, Losner J, Finley LWS. Mol Cell. 2026 Feb 26:S1097-2765(26)00099-7. doi: 10.1016/j.molcel.2026.02.004. 10.1016/j.molcel.2026.02.004 PubMed 41759528