pCW57-GFP-P2A-ByASPase
(Plasmid
#252094)
-
PurposeAll-in-one doxycycline inducible lentiviral vector for expression of Bacillus sp. YM55-1 derived aspartate lyase in combination with turbo GFP using the P2A self-cleaving peptide.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57-GFP-P2A-MCS (Neo)
-
Backbone manufacturerBroad Institute/Adam Karpf
- Backbone size w/o insert (bp) 8700
- Total vector size (bp) 10100
-
Modifications to backboneNA
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
-
Selectable markersNeomycin (select with G418) ; Turbo GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized Bacillus sp. YM55-1 derived aspartate ammonia-lyase
-
Alt nameaspA
-
SpeciesBacillus sp. YM55-1
-
Insert Size (bp)1458
-
MutationCodon optimized
-
GenBank IDAB028242.1
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-GFP-P2A-ByASPase was a gift from Lydia Finley (Addgene plasmid # 252094 ; http://n2t.net/addgene:252094 ; RRID:Addgene_252094) -
For your References section:
Aspartate availability drives differential engagement of the malate-aspartate shuttle. Brunner JS, Bridgeman AE, Jackson BT, Chakraborty S, Fagoaga-Eugui M, Paras KI, Xie A, Arnold PK, Losner J, Finley LWS. Mol Cell. 2026 Feb 26:S1097-2765(26)00099-7. doi: 10.1016/j.molcel.2026.02.004. 10.1016/j.molcel.2026.02.004 PubMed 41759528