Skip to main content

pQCXIP ALFA-mouse Fis1
(Plasmid #252267)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252267 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP
  • Backbone size w/o insert (bp) 7172
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse Fis1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    543
  • Entrez Gene
    Fis1 (a.k.a. 2010003O14Rik, Ttc11)
  • Promoter CMV
  • Tag / Fusion Protein
    • ALFA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP ALFA-mouse Fis1 was a gift from David Chan (Addgene plasmid # 252267 ; http://n2t.net/addgene:252267 ; RRID:Addgene_252267)
  • For your References section:

    Regulation of mitophagy by Fis1 and Fascin1-organized actin. Nakajima S, Wang TY, Chou TF, Chakrabarty Y, Chan DC. Curr Biol. 2026 Mar 9;36(5):1205-1219.e8. doi: 10.1016/j.cub.2026.01.062. Epub 2026 Feb 24. 10.1016/j.cub.2026.01.062 PubMed 41742405