pHAGE EGFP-mouse Parkin
(Plasmid
#252269)
-
PurposeLentiviral expression of EGFP-mouse Parkin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 6449
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse Parkin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2145
-
Entrez GenePrkn (a.k.a. Park2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI/Klenow, BamHI/Klenow (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE EGFP-mouse Parkin was a gift from David Chan (Addgene plasmid # 252269 ; http://n2t.net/addgene:252269 ; RRID:Addgene_252269) -
For your References section:
Regulation of mitophagy by Fis1 and Fascin1-organized actin. Nakajima S, Wang TY, Chou TF, Chakrabarty Y, Chan DC. Curr Biol. 2026 Mar 9;36(5):1205-1219.e8. doi: 10.1016/j.cub.2026.01.062. Epub 2026 Feb 24. 10.1016/j.cub.2026.01.062 PubMed 41742405