pLKO.1 hygro shRNA mouse Fis1
(Plasmid
#252270)
-
PurposeKnockdown of mouse Fis1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 hygro
- Backbone size w/o insert (bp) 7515
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA mouse Fis1
-
gRNA/shRNA sequenceACTACCGGCTCAAGGAATATG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)58
-
Entrez GeneFis1 (a.k.a. 2010003O14Rik, Ttc11)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5'
- 3′ sequencing primer ttagtttgtatgtctgttgct
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 hygro shRNA mouse Fis1 was a gift from David Chan (Addgene plasmid # 252270 ; http://n2t.net/addgene:252270 ; RRID:Addgene_252270)