Skip to main content

pLKO.1 hygro shRNA mouse Fascin1
(Plasmid #252271)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252271 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1 hygro
  • Backbone size w/o insert (bp) 7515
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA mouse Fascin1
  • gRNA/shRNA sequence
    ATCGACCGCGACACAAGAAAG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    58
  • Entrez Gene
    Fscn1 (a.k.a. Fan1, fascin-1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • 3′ sequencing primer ttagtttgtatgtctgttgct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 hygro shRNA mouse Fascin1 was a gift from David Chan (Addgene plasmid # 252271 ; http://n2t.net/addgene:252271 ; RRID:Addgene_252271)
  • For your References section:

    Regulation of mitophagy by Fis1 and Fascin1-organized actin. Nakajima S, Wang TY, Chou TF, Chakrabarty Y, Chan DC. Curr Biol. 2026 Mar 9;36(5):1205-1219.e8. doi: 10.1016/j.cub.2026.01.062. Epub 2026 Feb 24. 10.1016/j.cub.2026.01.062 PubMed 41742405