pLV-XRE-dUnaG-PEST-Myc
(Plasmid #252287)

• Purpose: Reporter for Ahr activity
• Depositing Lab: Roland Friedel
• Publication: Halperin et al. Ahr reporter (unpublished) (unpublished)

Backbone

• Vector backbone: pLenti-HRE-dUnaG (#124372)
• Backbone manufacturer: Roland Friedel
• Backbone size w/o insert (bp): 7728
• Total vector size (bp): 8549
• Modifications to backbone: XREs was inserted instead of the HRE element
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Xenobiotic Response Elements (XREs) core motif promoter
• Alt name: AhR response elements (AHREs)
• Alt name: Dioxin response elements (DREs)
• Species: M. musculus (mouse)
• Insert Size (bp): 145
• GenBank ID:
• Promoter: XRE (Xenobiotic response element 5X + CMV minimal promoter)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ccccttcacccttacttacttagcggccgc
• 3′ sequencing primer: ggtcgacctcgaggcatggtcgagatct

Gene/Insert 2

• Gene/Insert name: dUnaG-PEST-degron
• Species: Anguilla japonica
• Insert Size (bp): 615
• Tag / Fusion Protein:
  • c-myc tag (C terminal on insert)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ### The XRE element was obtained form Addgene plasmid pTXRE5-Z #112509 REF: A human aryl hydrocarbon receptor signaling pathway constructed in yeast displays additive responses to ligand mixtures. Miller CA 3rd. Toxicol Appl Pharmacol. 1999 Nov 1;160(3):297-303. doi: 10.1006/taap.1999.8769. 10.1006/taap.1999.8769 PubMed 10544064. ### The dUnaG plasmid was obtained from Dr. Friedemann Kiefer's laboratory REF: A novel family of fluorescent hypoxia sensors reveal strong heterogeneity in tumor hypoxia at the cellular level. R. Erapaneedi, V.V. Belousov, M. Schäfers, F. Kiefer. EMBO J., 35 (2016), pp. 102-113, 10.15252/embj.201592775. ### The pLenti-HRE-dUnaG backbone was obtain from Addgene plasmid #124372 REF: Sattiraju A, Kang S, Giotti B, Chen Z, Marallano VJ, Brusco C, Ramakrishnan A, Shen L, Tsankov AM, Hambardzumyan D, Friedel RH, Zou H. Immunity. 2023 Jul 7:S1074-7613(23)00274-1. doi: 10.1016/j.immuni.2023.06.017. 10.1016/j.immuni.2023.06.017

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry