35S:RUBY (pICSL11384)
(Plasmid
#252524)
-
PurposeLevel 1 plasmid in second position containing 35S:RUBY (pICSL11384)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47742_mRFP1
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRUBY
- Promoter Short 35s + Ω
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe RUBY gene originally comes from the lab of Yunde Zhao: https://www.nature.com/articles/s41438-020-00390-1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.01.14.699277 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
35S:RUBY (pICSL11384) was a gift from Sophien Kamoun (Addgene plasmid # 252524 ; http://n2t.net/addgene:252524 ; RRID:Addgene_252524)