Skip to main content
Addgene
Open Menu

huCofilin WT SSR
(Plasmid #252616)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 252616 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA 3.1
  • Backbone size w/o insert (bp) 5428
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1
  • Species
    H. sapiens (human)
  • Mutation
    silent mutations at nt 67 to 75 in which TCTTCAACG is replaced with AGCTCAACC and nt 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SSR is super resistent to cofilin shRNA (silent mutations in 2 different seqences). Silent mutations protect expression against 2 human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) targeting different sequences in cofilin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    huCofilin WT SSR was a gift from James Bamburg (Addgene plasmid # 252616 ; http://n2t.net/addgene:252616 ; RRID:Addgene_252616)

  • For your References section:

    ADF/cofilin regulates actomyosin assembly through competitive inhibition of myosin II binding to F-actin. Wiggan O, Shaw AE, DeLuca JG, Bamburg JR. Dev Cell. 2012 Mar 13;22(3):530-43. doi: 10.1016/j.devcel.2011.12.026. 10.1016/j.devcel.2011.12.026 PubMed 22421043
Related items: