Skip to main content
Addgene
Open Menu

Cof-1 shRNA rat
(Plasmid #252619)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 252619 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pShuttle-pol III H1
  • Backbone size w/o insert (bp) 7470
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1
  • gRNA/shRNA sequence
    AAGGTGTTCAATGACATGAAA
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Cfl1 (a.k.a. Cof)
  • Promoter pol III H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This shRNA knocks down cofilin expression in both rat and mouse (1 nt different) cells but weakly in human cells (2 nt different). shRNA sequence is from Mouneimne et al., 2004 (doi: 10.1083/jcb.200405156).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cof-1 shRNA rat was a gift from James Bamburg (Addgene plasmid # 252619 ; http://n2t.net/addgene:252619 ; RRID:Addgene_252619)
Related items: