p-cymR-cre[LVA]-loxPP-eyfp
(Plasmid
#252620)
-
PurposeCumate-inducible Cre recombinase; cumate activates P_cymRC to express cre[LVA], which excises loxP-flanked transcriptional terminators and activates eyfp. Use with Marionette Sensor Collection strains
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A-Kan
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecymRAM + PcymRC-cre[LVA] + PW4-loxP-TT-loxP-eyfp
-
Insert Size (bp)3425
- Promoter PcymRC
-
Tag
/ Fusion Protein
- cre[LVA] (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer gaggcataaattccgtcagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycymR^AM+ PcymRC + eyfp received from Christopher Voigt (Addgene plasmid #108513); cre recombinase received from Niels Geijsen (Addgene plasmid #62730); PW4 and loxP synthesized by Twist Bioscience, sequences are from Sheets et al. 2020 (doi: 10.1021/acssynbio.9b00395); TT terminators ECK120033736 and L3S2P11 were synthesized by Twist Bioscience, sequences are from Chen et al. 2013 (doi: 10.1038/nmeth.2515).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.02.616356 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-cymR-cre[LVA]-loxPP-eyfp was a gift from Andrea Giometto (Addgene plasmid # 252620 ; http://n2t.net/addgene:252620 ; RRID:Addgene_252620) -
For your References section:
Tunable Low-Rate Genomic Recombination with Cre-lox in Escherichia coli : A Versatile Tool for Environmental Biosensing and Synthetic Biology. Garabello E, Yoon H, Reid MC, Giometto A. bioRxiv [Preprint]. 2025 Sep 2:2024.10.02.616356. doi: 10.1101/2024.10.02.616356. 10.1101/2024.10.02.616356 PubMed 40949998