p-ArsRBS2-cre[LVA]-loxPP-syfp2
(Plasmid
#252621)
-
PurposeCre-recombinase based arsenite biosensor. ArsR promoter regulates cre expression, which excises two transcriptional terminators leading to cell fluorescence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A-Kan
-
Backbone manufacturerChristopher Voigt (Addgene plasmid #108517)
-
Modifications to backboneAdded Ampicillin resistance gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameParsR-arsR-cre[LVA] + PrpsL-loxP-TT-loxP-syfp2
-
Insert Size (bp)2951
- Promoter ParsR
-
Tag
/ Fusion Protein
- cre[LVA] (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TCCAGTTCGATGTAACCCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid backbone received from Christopher Voigt (Addgene plasmid #108517). ParsR-arsR received from Alexander Poulain; cre recombinase gene received from Niels Geijsen (Addgene plasmid #62730); TT terminators ECK120033736 and L3S2P11 were synthesized by Twist Bioscience, sequences are from Chen et al. 2013 (doi: 10.1038/nmeth.2515); PrpsL-syfp2 received from Johan Paulsson.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.02.616356 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-ArsRBS2-cre[LVA]-loxPP-syfp2 was a gift from Andrea Giometto (Addgene plasmid # 252621 ; http://n2t.net/addgene:252621 ; RRID:Addgene_252621) -
For your References section:
Tunable Low-Rate Genomic Recombination with Cre-lox in Escherichia coli : A Versatile Tool for Environmental Biosensing and Synthetic Biology. Garabello E, Yoon H, Reid MC, Giometto A. bioRxiv [Preprint]. 2025 Sep 2:2024.10.02.616356. doi: 10.1101/2024.10.02.616356. 10.1101/2024.10.02.616356 PubMed 40949998