pKLV2-U6gRNA5(sgIL8-1)-PGKpuro2ABFP-W
(Plasmid
#252913)
-
PurposeExpression vector for gRNA with Puro and tagBFP selection markers
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
-
Backbone manufacturerKosuke Yusa
- Backbone size w/o insert (bp) 8648
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCXCL8
-
gRNA/shRNA sequenceGAAGGCTGCCAAGAGAGCCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneCXCL8 (a.k.a. GCP-1, GCP1, IL8, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1, SCYB8)
- Promoter human U6 promoter, mouse PGK promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(sgIL8-1)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 252913 ; http://n2t.net/addgene:252913 ; RRID:Addgene_252913)