pFlagTurboNTD(N3)
(Plasmid
#253059)
-
PurposeContains a multiple cloning site to insert a gene upstream of Flag-TurboID (N-term aa1-194)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepEGFPC1 (deltaEGFP)
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3999
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTurboID-NTD
-
SpeciesE. coli
-
Insert Size (bp)615
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTACATCAATGGGCGTGGATAG
- 3′ sequencing primer GCTGTTCGCCACTATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
in-house vector to create TurboNTD fusions
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlagTurboNTD(N3) was a gift from Laura Trinkle-Mulcahy (Addgene plasmid # 253059 ; http://n2t.net/addgene:253059 ; RRID:Addgene_253059)