Skip to main content

pFlagTurboNTD(N3)
(Plasmid #253059)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 253059 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pEGFPC1 (deltaEGFP)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3999
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TurboID-NTD
  • Species
    E. coli
  • Insert Size (bp)
    615
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTACATCAATGGGCGTGGATAG
  • 3′ sequencing primer GCTGTTCGCCACTATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

in-house vector to create TurboNTD fusions

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFlagTurboNTD(N3) was a gift from Laura Trinkle-Mulcahy (Addgene plasmid # 253059 ; http://n2t.net/addgene:253059 ; RRID:Addgene_253059)
  • For your References section:

    SplitTurboID mapping of dimeric protein phosphatase complex interactomes. Rajkumar A, Gaudreau-Lapierre A, Anthony CLF, Nguyen V, Ooi S, Campuzano D, Trinkle-Mulcahy L. iScience. 2026 Feb 28;29(4):115195. doi: 10.1016/j.isci.2026.115195. eCollection 2026 Apr 17. 10.1016/j.isci.2026.115195 PubMed 41869563