pmycTurboCTD(N3)-LifeAct
(Plasmid
#253065)
-
PurposeExpression of LifeAct-mycTurboCTD
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepmycTurboCTD(N3)
-
Backbone manufacturerLaura Trinkle-Mulcahy
- Backbone size w/o insert (bp) 4398
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeAct
-
Alt nameAbp140 (aa1-17)
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)51
-
Entrez GeneABP140 (a.k.a. YOR239W, TRM140, YOR240W)
- Promoter CMV
-
Tag
/ Fusion Protein
- mycTurboCTD (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GTACATCAATGGGCGTGGATAG
- 3′ sequencing primer GCTGTTCGCCACTATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmycTurboCTD(N3)-LifeAct was a gift from Laura Trinkle-Mulcahy (Addgene plasmid # 253065 ; http://n2t.net/addgene:253065 ; RRID:Addgene_253065) -
For your References section:
SplitTurboID mapping of dimeric protein phosphatase complex interactomes. Rajkumar A, Gaudreau-Lapierre A, Anthony CLF, Nguyen V, Ooi S, Campuzano D, Trinkle-Mulcahy L. iScience. 2026 Feb 28;29(4):115195. doi: 10.1016/j.isci.2026.115195. eCollection 2026 Apr 17. 10.1016/j.isci.2026.115195 PubMed 41869563