Skip to main content

pmycTurboCTD(N3)-LifeAct
(Plasmid #253065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 253065 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pmycTurboCTD(N3)
  • Backbone manufacturer
    Laura Trinkle-Mulcahy
  • Backbone size w/o insert (bp) 4398
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LifeAct
  • Alt name
    Abp140 (aa1-17)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    51
  • Entrez Gene
    ABP140 (a.k.a. YOR239W, TRM140, YOR240W)
  • Promoter CMV
  • Tag / Fusion Protein
    • mycTurboCTD (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GTACATCAATGGGCGTGGATAG
  • 3′ sequencing primer GCTGTTCGCCACTATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmycTurboCTD(N3)-LifeAct was a gift from Laura Trinkle-Mulcahy (Addgene plasmid # 253065 ; http://n2t.net/addgene:253065 ; RRID:Addgene_253065)
  • For your References section:

    SplitTurboID mapping of dimeric protein phosphatase complex interactomes. Rajkumar A, Gaudreau-Lapierre A, Anthony CLF, Nguyen V, Ooi S, Campuzano D, Trinkle-Mulcahy L. iScience. 2026 Feb 28;29(4):115195. doi: 10.1016/j.isci.2026.115195. eCollection 2026 Apr 17. 10.1016/j.isci.2026.115195 PubMed 41869563