CRISPRi sgNF2-1
(Plasmid
#253094)
-
PurposeCRISPRi single-guide against NF2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCRISPRi
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNF2
-
gRNA/shRNA sequenceGTCGGGACGGGACCCCTAGA
-
SpeciesH. sapiens (human)
-
Entrez GeneNF2 (a.k.a. ACN, BANF, SCH, SWNV, merlin-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPRi sgNF2-1 was a gift from Harish Vasudevan (Addgene plasmid # 253094 ; http://n2t.net/addgene:253094 ; RRID:Addgene_253094) -
For your References section:
Functional interactions between neurofibromatosis tumor suppressors underlie Schwann cell tumor de-differentiation and treatment resistance. Vasudevan HN, Payne E, Delley CL, John Liu S, Mirchia K, Sale MJ, Lastella S, Nunez MS, Lucas CG, Eaton CD, Casey-Clyde T, Magill ST, Chen WC, Braunstein SE, Perry A, Jacques L, Reddy AT, Pekmezci M, Abate AR, McCormick F, Raleigh DR. Nat Commun. 2024 Jan 12;15(1):477. doi: 10.1038/s41467-024-44755-9. 10.1038/s41467-024-44755-9 PubMed 38216572