Skip to main content

pBJ2363 GFP mouse capping protein beta2 (R15A,Y79A)
(Plasmid #253187)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253187 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFPC1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mouse capping protein beta2 (R15A,Y79A). GFP-tagged.
  • Species
    M. musculus (mouse)
  • Mutation
    CP beta2 (R15 to A, Y79 to A).
  • GenBank ID
    NM_009798.4 NM_009798.4
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBJ2363 GFP mouse capping protein beta2 (R15A,Y79A) was a gift from John Cooper (Addgene plasmid # 253187 ; http://n2t.net/addgene:253187 ; RRID:Addgene_253187)
  • For your References section:

    CPI motif interaction is necessary for capping protein function in cells. Edwards M, McConnell P, Schafer DA, Cooper JA. Nat Commun. 2015 Sep 28;6:8415. doi: 10.1038/ncomms9415. 10.1038/ncomms9415 PubMed 26412145