pBJ2363 GFP mouse capping protein beta2 (R15A,Y79A)
(Plasmid
#253187)
-
PurposeExpresses GFP fusion of mouse capping protein beta2 subunit with two point mutations that inactivate binding to CPI motifs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFPC1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMouse capping protein beta2 (R15A,Y79A). GFP-tagged.
-
SpeciesM. musculus (mouse)
-
MutationCP beta2 (R15 to A, Y79 to A).
-
GenBank IDNM_009798.4 NM_009798.4
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ2363 GFP mouse capping protein beta2 (R15A,Y79A) was a gift from John Cooper (Addgene plasmid # 253187 ; http://n2t.net/addgene:253187 ; RRID:Addgene_253187) -
For your References section:
CPI motif interaction is necessary for capping protein function in cells. Edwards M, McConnell P, Schafer DA, Cooper JA. Nat Commun. 2015 Sep 28;6:8415. doi: 10.1038/ncomms9415. 10.1038/ncomms9415 PubMed 26412145