Skip to main content

pBJ2366 YFP CARMIL1 Human
(Plasmid #253188)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253188 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEYFPC1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CARMIL1, human, YFP fusion
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_017640.6 NM_017640.6
  • Promoter CMV
  • Tag / Fusion Protein
    • YFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBJ2366 YFP CARMIL1 Human was a gift from John Cooper (Addgene plasmid # 253188 ; http://n2t.net/addgene:253188 ; RRID:Addgene_253188)
  • For your References section:

    Physiological role of the interaction between CARMIL1 and capping protein. Edwards M, Liang Y, Kim T, Cooper JA. Mol Biol Cell. 2013 Oct;24(19):3047-55. doi: 10.1091/mbc.E13-05-0270. Epub 2013 Jul 31. 10.1091/mbc.E13-05-0270 PubMed 23904264