pBJ2366 YFP CARMIL1 Human
(Plasmid
#253188)
-
PurposeExpresses YFP fusion of Human CARMIL1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEYFPC1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCARMIL1, human, YFP fusion
-
SpeciesH. sapiens (human)
-
GenBank IDNM_017640.6 NM_017640.6
- Promoter CMV
-
Tag
/ Fusion Protein
- YFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ2366 YFP CARMIL1 Human was a gift from John Cooper (Addgene plasmid # 253188 ; http://n2t.net/addgene:253188 ; RRID:Addgene_253188) -
For your References section:
Physiological role of the interaction between CARMIL1 and capping protein. Edwards M, Liang Y, Kim T, Cooper JA. Mol Biol Cell. 2013 Oct;24(19):3047-55. doi: 10.1091/mbc.E13-05-0270. Epub 2013 Jul 31. 10.1091/mbc.E13-05-0270 PubMed 23904264