pSynITR_DD
(Plasmid
#253227)
-
PurposeThis is a DD-ITR AAV Production plasmid that contains the SynITR sequence as published in PMID: 39868534
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEnhanced Green Fluorescent Protein
-
Alt nameeGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)720
Gene/Insert 2
-
Gene/Insert nameSynITR
-
Speciessynthetic
-
Insert Size (bp)167
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GCAGATTGTACTGAGAGTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSynITR_DD was a gift from Matthew Hirsch (Addgene plasmid # 253227 ; http://n2t.net/addgene:253227 ; RRID:Addgene_253227) -
For your References section:
AAV vector transduction restriction and attenuated toxicity in hESCs via a rationally designed inverted terminal repeat. Song L, Hasegawa T, Brown NJ, Bower JJ, Samulski RJ, Hirsch ML. Nucleic Acids Res. 2025 Jan 24;53(3):gkaf013. doi: 10.1093/nar/gkaf013. 10.1093/nar/gkaf013 PubMed 39868534