Skip to main content
Addgene
Open Menu

pSHARE-TRACE-mU1-empty
(Plasmid #253332)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253332 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pSHARE-TRACE-mU1-empty
  • Backbone manufacturer
    This publication
  • Backbone size (bp) 8991
  • Modifications to backbone
    The pLARRY empty vector (Addgene #140025) was first modified to insert a TruSeq sequencing adaptor (ACACTCTTTCCCTACACGACGCTCTTCCGATCT) upstream of the barcode insertion site to allow for direct amplification. Additional sequence, including a mouse U1 hairpin, was introduced downstream of the barcode site to promote nuclear translocation of RNA transcripts and more efficient SHARE-seq capture.
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter EF1a
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.13.638099 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHARE-TRACE-mU1-empty was a gift from Jason Buenrostro (Addgene plasmid # 253332 ; http://n2t.net/addgene:253332 ; RRID:Addgene_253332)

  • For your References section:

    Clonal memory of colitis accumulates and promotes tumor growth. Nagaraja S, Ojeda-Miron L, Zhang R, Oreskovic E, Hu Y, Zeve D, Sharma K, Hyman RR, Zhang Q, Castillo A, Breault DT, Yilmaz OH, Buenrostro JD. bioRxiv [Preprint]. 2025 Feb 17:2025.02.13.638099. doi: 10.1101/2025.02.13.638099. 10.1101/2025.02.13.638099 PubMed 40027722
Related items: