V12
(Plasmid
#253336)
-
PurposeFully genetically encoded protein tag for CryoET labelling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNRIII
- Backbone size w/o insert (bp) 5423
- Total vector size (bp) 7682
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameV12
-
SpeciesSynthetic
-
Insert Size (bp)1536
- Promoter T7
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer cgaaaacctgtacttccagggatccggcgatcagttgtataagcagatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.01.16.700029 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V12 was a gift from Qiangjun Zhou (Addgene plasmid # 253336 ; http://n2t.net/addgene:253336 ; RRID:Addgene_253336) -
For your References section:
Fully genetically encoded low-molecular-weight protein tags with defined shapes for direct molecular identification by cryo-electron tomography. Luo F, Sun R, Chalkley O, Li P, Zhou Q. bioRxiv [Preprint]. 2026 Jan 20:2026.01.16.700029. doi: 10.64898/2026.01.16.700029. 10.64898/2026.01.16.700029 PubMed 41648103