TOMO70_NTD_Delta6_GFP
(Plasmid
#253341)
-
Purposemitochondrial TOMO70 NTD tagged with Delta6 and GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 9216
- Total vector size (bp) 12669
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOMO70-NTD-Delta6-GFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3450
-
Entrez GeneTOMM70 (a.k.a. TOMM70A, Tom70)
- Promoter UBC
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcgactctagaggatcgaattcatggccgcctctaaacctgtggagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.01.16.700029 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TOMO70_NTD_Delta6_GFP was a gift from Qiangjun Zhou (Addgene plasmid # 253341 ; http://n2t.net/addgene:253341 ; RRID:Addgene_253341) -
For your References section:
Fully genetically encoded low-molecular-weight protein tags with defined shapes for direct molecular identification by cryo-electron tomography. Luo F, Sun R, Chalkley O, Li P, Zhou Q. bioRxiv [Preprint]. 2026 Jan 20:2026.01.16.700029. doi: 10.64898/2026.01.16.700029. 10.64898/2026.01.16.700029 PubMed 41648103