co LuxDEC(KZK)
(Plasmid
#253533)
-
PurposeExpress luciferin biosynthesis of human codon-optimized LuxDEC in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameco LuxD-P2A-co LuxE-T2A-co LuxC
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggagaacgagagcaagtacaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
co LuxDEC(KZK) was a gift from Takeharu Nagai (Addgene plasmid # 253533 ; http://n2t.net/addgene:253533 ; RRID:Addgene_253533) -
For your References section:
Autonomous multicolor bioluminescence imaging in bacteria, mammalian, and plant hosts. Kusuma SH, Kakizuka T, Hattori M, Nagai T. Proc Natl Acad Sci U S A. 2024 Oct 8;121(41):e2406358121. doi: 10.1073/pnas.2406358121. Epub 2024 Oct 2. 10.1073/pnas.2406358121 PubMed 39356665